View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_90 (Length: 251)
Name: NF0818_low_90
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_low_90 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 7855633 - 7855393
Alignment:
| Q |
1 |
atcaacggcatgaacgagattctagcgagtacaagaaatgttgaaacaaaccaatgacttcttgattgtaatctttcaaaaatcaaaattgatgaaggaa |
100 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7855633 |
atcaaccgcatgaacgagattttagcgagtacaagaaatgttgaaacaaaccaatgacttcttgattgtaatctttcaaaaatcaaaattgatgaaggaa |
7855534 |
T |
 |
| Q |
101 |
tgaagtccaaagctttaacatgttctatatgtttggcggatctcttggttggatcgatagcaattcagttgtcatgttcgcatttgtaccatgaaagagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7855533 |
tgaagtccaaagctttaacatgttctatatgtttggtggatctctcggttggatcgatagcaattcagttgtcatgttcgcatttgtaccatg-aagagt |
7855435 |
T |
 |
| Q |
201 |
gtgttgtaaaatggctagatagatcaaacacctgccctttgt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7855434 |
gtgttgtaaaatggctagatagatcaaacacctttcctttgt |
7855393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University