View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_91 (Length: 251)
Name: NF0818_low_91
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0818_low_91 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 45023977 - 45024203
Alignment:
Q |
1 |
attatttcttatcggctactctttggagtgtggtacaaagccacctttgtaaaacggtcgataaaatacacatgaaaaataggaagaat-----cggcgt |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
T |
45023977 |
attatttcttatcggctactctttggagtgtggtacacagccacctttgtaaaacggtcgataaaaaacacatgaaaaataggaagaatcgaatcggcgt |
45024076 |
T |
 |
Q |
96 |
tgtatttaattaattaatgctaactaacttgatatatatgttaaccgataaaaactgacacacaaaagagttaattatgttaaagacaacaaaactcttg |
195 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
45024077 |
tgtatttaattaattaatgctaactaacttgatatatatgttaaccgataaaaactgacacacaaaagagttaattatgttaaagacaagaaaactcttg |
45024176 |
T |
 |
Q |
196 |
aaaaatgagaaaagctgcatgagtgac |
222 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
45024177 |
aaaaatgagaaaagctgcatgagtgac |
45024203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 291 times since January 2019
Visitors: 5834