View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0818_low_97 (Length: 250)

Name: NF0818_low_97
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0818_low_97
NF0818_low_97
[»] chr2 (1 HSPs)
chr2 (9-250)||(17233249-17233490)


Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 17233490 - 17233249
Alignment:
9 gaagaatatgatcaaaagtttaaagaaataatcctttggaataaacatgatgaagtatttattgtctcaaataacaacactagaaagaaatttacagatg 108  Q
    |||||| ||||| ||||||||||||||||| ||||||||||||||||  ||||||| ||||||||||||||||||||||||||||||||||| |||||||    
17233490 gaagaaaatgattaaaagtttaaagaaatactcctttggaataaacaatatgaagtgtttattgtctcaaataacaacactagaaagaaattcacagatg 17233391  T
109 ttgctctgtagcagtctggcaaatttttcaagagtgaagagtgcactatgaataggaactgcaaccgcaagcaataagaatgagaaccccataagggcct 208  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||    
17233390 ttgctctgaagcagtctggcaaatttttcaagagtgaagagtgcactatgaataagaaccgcaaccgcaagcaataagaatgagaaccccataagggcct 17233291  T
209 aatatgtgcaacaacacccaccgcaaagaaatgacacaagga 250  Q
    |||||||||||||||||||||| |||||||||||||| ||||    
17233290 aatatgtgcaacaacacccaccacaaagaaatgacactagga 17233249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University