View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0818_low_98 (Length: 246)
Name: NF0818_low_98
Description: NF0818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0818_low_98 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 28485300 - 28485064
Alignment:
| Q |
1 |
ttcaaataaatgtattaatttattaacatacttcatattagaaagattttgataaagcaagttctttatccacaannnnnnnnnnnnnnnc---cttaac |
97 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28485300 |
ttcaaataaatgtattaatttattaacatgattcatattagaaagattttgataaagcaagttctttatccacaattattttttatttttttttcttaac |
28485201 |
T |
|
| Q |
98 |
gctccttcc-----gaaggagaccctggtaattcggagtttagctgggaggtaagtaaagtctgtctgatcaacattcagctgatcgaccatggatctat |
192 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28485200 |
gctccttcctctaggaaggagaccctggtaattcggagtttagctgggaggtaagtaaagtctgtctgatcaacattcagctgatcgaccatggatctat |
28485101 |
T |
|
| Q |
193 |
tgctctaataaaaaatactcaataactatatagtttc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28485100 |
tgctctaataaaaaatactcaataactatatagtttc |
28485064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 168 times since January 2019
Visitors: 5832