View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0819_high_11 (Length: 304)
Name: NF0819_high_11
Description: NF0819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0819_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 32 - 228
Target Start/End: Complemental strand, 1036931 - 1036735
Alignment:
Q |
32 |
agcataggcaaatggcatgatctatttcaattgacatggtttcttattgatatatttcatttcaaaagatattgtagaacaagcttgtgaaactctagtg |
131 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
1036931 |
agcataggcaaatggcatgatctatttcaattgacatggtttcttattgatatatttcatttcaaaagatattgtacaacaagcttgtgaaactctagtg |
1036832 |
T |
 |
Q |
132 |
ttgaatcatgatcaagttgaaatgtttataagatttgatttactacgctattgtatcatactatacaaataaaaataatttgtcttgagcaacaaat |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1036831 |
ttgaatcatgatcaagttgaaatgtttataagatttgatttactacgctattgtatcatactatacaaataaaaataatttgtcttgagcaacaaat |
1036735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 50 times since January 2019
Visitors: 5776