View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0819_high_8 (Length: 331)
Name: NF0819_high_8
Description: NF0819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0819_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 6 - 294
Target Start/End: Original strand, 9534580 - 9534868
Alignment:
Q |
6 |
agcagcacagatagtgaaacacaagattaatactgttatgattttgtgtgtttagttttctacaaatttgtgctctttaaagggacggttttgataggct |
105 |
Q |
|
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9534580 |
agcaccacaaatagtgaaacacaagattaatactgttatgattttgtgtgtttagttttctacaaatttgtgctctttaaagggacggttttgataggct |
9534679 |
T |
 |
Q |
106 |
tatccatgcctttgaaaatattggaaaagagaaagataagatggagacagctggtttaattggaagaaaggattgatggttataaacatcgnnnnnnnnn |
205 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9534680 |
tatccctgcctttgaaaatattggaaaagagaaagataagatggagacaactggtttaattggaagaaaggattgatggttataaacatcg-aaaaaaaa |
9534778 |
T |
 |
Q |
206 |
tctagtatttcattg-tttttatgtactatttatatattcttttaaaggatattctaccacttaatggtattaatatcatactacatata |
294 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9534779 |
tctagtatttcattgttttttatgtactatttatatattcttttaaaggatattctaccacttaatggtattaatatcatactacatata |
9534868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4703 times since January 2019
Visitors: 5752