View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0819_low_13 (Length: 400)
Name: NF0819_low_13
Description: NF0819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0819_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 2e-56; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 11 - 134
Target Start/End: Original strand, 43879562 - 43879685
Alignment:
| Q |
11 |
cacagatgaaatgaagtcttaaaagatcttaaatttgtagcatatggcaaattaaaagtaattaattcaatgcgtacaaatacagggagagtatctcaac |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43879562 |
cacaaatgaaatgaagtcttaaaagatcttaaatttgtagcatagggcaaaataaaagtaattaattcaatgcgtacaaatacagggagagtatctcaac |
43879661 |
T |
 |
| Q |
111 |
tttattctgggcataaagttccaa |
134 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43879662 |
tttattctgggcataaagttccaa |
43879685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 193 - 266
Target Start/End: Original strand, 43879701 - 43879774
Alignment:
| Q |
193 |
gtcgtgtcgtgtgcatatttgaaatagaaatagaggcaccttcttaattggttattgtttcagtatggcatgtg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43879701 |
gtcgtgtcgtgtgcatatttgaaatagaaatagaggcaccttcttaattggttattgtttcagtatggcatgtg |
43879774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 321 - 371
Target Start/End: Original strand, 43879856 - 43879910
Alignment:
| Q |
321 |
ttaactaaatactcattcaatcagt----tagctcaatcaatcgagctacacatc |
371 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
43879856 |
ttaactacatactcattcaatcagttagctagctcaatcaatcgagctgcacatc |
43879910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University