View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0819_low_19 (Length: 349)
Name: NF0819_low_19
Description: NF0819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0819_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 123 - 321
Target Start/End: Original strand, 24251268 - 24251467
Alignment:
| Q |
123 |
ggttgtccagcaccatgtatctatacaatacatataccatttgattttcttt-aattacnnnnnnnncattctccacgtaacattaacgattataagtga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
24251268 |
ggttgtccagcaccatgtatctatacaatacatataccatttgatttttttttaattacctttttttcattctccaagtaacattaacggttataagtga |
24251367 |
T |
|
| Q |
222 |
tgtatttcatatacggtattgaatatgattgtcagtttttaattgttcaaataatatcactcttctttttcaatcaattgtggactcaaattgagatatt |
321 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||| ||||||||||| |||| ||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
24251368 |
tgtatttcttatacggtattgaatatggttgtcagtttttagctgttcaaataacatcattcttctttttcaatcaattatggacccaaattgagatatt |
24251467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 24251161 - 24251205
Alignment:
| Q |
16 |
atcacaggtaaaacgcctacaaactcatttttatagttattagta |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24251161 |
atcacaggtaaaacgcctacaaactcatttttatagttattagta |
24251205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6439 times since January 2019
Visitors: 5768