View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0819_low_27 (Length: 301)
Name: NF0819_low_27
Description: NF0819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0819_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 171 - 218
Target Start/End: Original strand, 36956166 - 36956213
Alignment:
Q |
171 |
ttgggttgagtagagagaagtacttactacatgttgcagtatggagac |
218 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
36956166 |
ttgggttgtgtagagagaagtacttactacatgttgcagtatagagac |
36956213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6628 times since January 2019
Visitors: 5769