View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0819_low_30 (Length: 279)
Name: NF0819_low_30
Description: NF0819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0819_low_30 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 42551139 - 42551422
Alignment:
| Q |
1 |
tcttcgtgggaatgatttgaacccgcttgatgaacatgagcttaggtcatctcggaggaagtctttgagcaacagctagggctttgaggtatatttggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
42551139 |
tcttcgtgggaatgatttgaacccgcttgatgaacatgagcttaggtcatctcggaggtagtctttgagcaaaagggtaggctttgaggtatatttggtt |
42551238 |
T |
|
| Q |
101 |
ggttttattattagagaattatcacgacgtgaaggtttgcaaatatttgaagccatgtatagaac----aaagtagctttgctatatgaatatttcaaga |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
42551239 |
ggttttattattagagaattatcacgacgtgaaggtttgcaaatatttgaagccatgtatagaacaattaaagtagatttgctatatgaatatttcaaga |
42551338 |
T |
|
| Q |
197 |
gaatacactcataagaaaattgatgaactatggagaaaag-ttgtatggtgcagaagtttagatataagcaacatttatatatt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42551339 |
gaatacactcataagaaaattgatgaactatggagaaaagagtgtatggtgcagaagtttagatataagcaacatttatatatt |
42551422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 76 times since January 2019
Visitors: 5776