View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0819_low_33 (Length: 266)
Name: NF0819_low_33
Description: NF0819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0819_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 34239245 - 34239499
Alignment:
| Q |
1 |
tagatagtaaccaactttgcaacacctgggcgaagaggcaacaattttttctccacaagttccatgaatagttctgtcttccgcttgtgaagcgaagcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34239245 |
tagatagtaaccaactttgcaacacctgggcgaagaggcaacaattttttctccacaagttccatgaatagttctgtcttccgcttgtgaagcgaagcta |
34239344 |
T |
 |
| Q |
101 |
tgaaatctttcctttcttgttcacctgttggggcattcgcaggccaacctgtcttgttaaagtacgccgtcatcctacnnnnnnncacatcaattatagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34239345 |
tgaaatctttcctttcttgttcacctgttggggcattcgcaggccaacctgtcttgttaaagtacgccgtcatcctacaaaaaaacacatcaattatagc |
34239444 |
T |
 |
| Q |
201 |
ttcaagttcaaaacnnnnnnntattgtacgagtatttgaattactactcaccttt |
255 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
34239445 |
ttcaagttcaaaacaaaaaaatattgtacaagtatttgaattactactcaccttt |
34239499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University