View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0819_low_37 (Length: 252)
Name: NF0819_low_37
Description: NF0819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0819_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 222
Target Start/End: Complemental strand, 28114197 - 28113982
Alignment:
Q |
7 |
agaagcaaaggaaaatggttggtgatgcttcaagaaattattcatatcatcttttaacaaggaaattattcatatcatgaatcatagttcaacttattca |
106 |
Q |
|
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28114197 |
agaaccaaaggaaaatggttggtgatacttcaagaaattattcatatcattttttaacaaggaaattattcatatcatgaatcatagttcaacttattca |
28114098 |
T |
 |
Q |
107 |
tctggttcaattatgagtgaagtagataacaaataaatagtaagaactggttcaatataatctaggtcaaaccctaggacaaattgtctgattttgtttc |
206 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
28114097 |
tctggttcaattatgagtgaagtagataacaaataaatagtaagaactggttcaatataatctaggtcaaaccctaggacaaattctctgattttgtttc |
28113998 |
T |
 |
Q |
207 |
tttataggtaaatgtt |
222 |
Q |
|
|
|||||||||||||||| |
|
|
T |
28113997 |
tttataggtaaatgtt |
28113982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University