View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0819_low_39 (Length: 247)
Name: NF0819_low_39
Description: NF0819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0819_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 83 - 221
Target Start/End: Complemental strand, 45346665 - 45346527
Alignment:
Q |
83 |
gctcgactattttgacggaatgaacaaaactagatggtatgctatgcgggttggcctcagcccaagagaaaaagaagaaaaaacatttgcttcccgcgcg |
182 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
45346665 |
gctcgactattttgagggaatgaacaaaactagatggtatgctgtgcgggttggcctcagcccaagagaaaaagaagaaaaagcatttgcttcccgcgcg |
45346566 |
T |
 |
Q |
183 |
agggttttctcgatttaggggcaaagatggaaacggaag |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45346565 |
agggttttctcgatttaggggcaaagatggaaacggaag |
45346527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 110
Target Start/End: Original strand, 3788971 - 3789011
Alignment:
Q |
70 |
taagttaactcatgctcgactattttgacggaatgaacaaa |
110 |
Q |
|
|
|||||||||| ||||||| |||||||||||| ||||||||| |
|
|
T |
3788971 |
taagttaacttatgctcggctattttgacgggatgaacaaa |
3789011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 111
Target Start/End: Original strand, 684233 - 684273
Alignment:
Q |
72 |
agttaactcatgctcgactattttgac-ggaatgaacaaaa |
111 |
Q |
|
|
|||||||||||||||||||||||| || ||||||||||||| |
|
|
T |
684233 |
agttaactcatgctcgactattttaacgggaatgaacaaaa |
684273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University