View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821-Insertion-11 (Length: 195)
Name: NF0821-Insertion-11
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821-Insertion-11 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 6 - 195
Target Start/End: Complemental strand, 45650425 - 45650236
Alignment:
| Q |
6 |
caataataacaacttgttttctagtaatattagtagtcttctgttcaacctgacactttcatcatcattttcacctattttacttcattgttccatccat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45650425 |
caataataacaacttgttttctagtaatagtagtagtcttctgttcaacctgacactttcatcatcattttcacctattttacttcattgttccatccat |
45650326 |
T |
|
| Q |
106 |
tctcatcacgtgcttttctgacacnnnnnnnncttccctgccatctgggtagttttcagtcttcactttgttttctctcactctttatta |
195 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45650325 |
tctcatcacgtgcttttctgacacttttttttcttccctgccatctgggtagttttcagtcttcactttgttttctctcactctttatta |
45650236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4807 times since January 2019
Visitors: 5752