View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821-Insertion-13 (Length: 181)
Name: NF0821-Insertion-13
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821-Insertion-13 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 44581376 - 44581556
Alignment:
Q |
1 |
cccaacaccacctatgcccatgagtgggagtggcggctccgccaccgctattgaccgcatccaccatattccgccactgtctatcttaagcaacaagtga |
100 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44581376 |
cccaccaccacctatgcccatgagtgggagtggcggctccgccactgctattgaccgcatccaccatattccgccactgtctatcttaagcaacaagtga |
44581475 |
T |
 |
Q |
101 |
agctcaatcgagggatcaaacacagtcgacaaatcactaatagaccttatttcaaacttggctaattagttggtgcacatg |
181 |
Q |
|
|
||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
44581476 |
agctcaatcgagggatcaaacacagtcgataaataactaatagaccttatttcaaacttggctaattagttggcgcacatg |
44581556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4961 times since January 2019
Visitors: 5753