View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821-Insertion-14 (Length: 146)
Name: NF0821-Insertion-14
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821-Insertion-14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 10 - 146
Target Start/End: Complemental strand, 29007240 - 29007103
Alignment:
| Q |
10 |
tataacttataattcagcttaaacacgttttcttgtgt--tgtgcaatcgacacgtcaagagcaccgacacttgtgatcgaaaacgtatcagtgaattgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29007240 |
tataacttataattcagcttaaacacatttttttgtgtgctgtgcaatcgacacgtcaagagcaccgacacttgtgatcgaaaacgtatc--tgaattgt |
29007143 |
T |
 |
| Q |
108 |
a-cattgtcaatatcctgatgcatgtgtttgtgtctgtgc |
146 |
Q |
| |
|
| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
29007142 |
atcattttcaatatcctgatgcatgtgtttgtgtccgtgc |
29007103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University