View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821-Insertion-8 (Length: 176)
Name: NF0821-Insertion-8
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821-Insertion-8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 8 - 135
Target Start/End: Complemental strand, 45699163 - 45699036
Alignment:
| Q |
8 |
ctggtccctctattattagaagattagaagttgtttgttaagtgggtccgtccgtccgtcgtccatttgagaatattattgtttgtctattggtcgccgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45699163 |
ctggtccctctattattagaagattagaagttgtttgttaagtgggtccgtccgtccgtcgtccatttgagaatattattgtttgtctattggtcgccgc |
45699064 |
T |
|
| Q |
108 |
tcacgaaccctagattcattcattctta |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45699063 |
tcacgaaccctagattcattcattctta |
45699036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4644 times since January 2019
Visitors: 5751