View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821-Insertion-9 (Length: 217)
Name: NF0821-Insertion-9
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821-Insertion-9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 8 - 217
Target Start/End: Complemental strand, 5549497 - 5549288
Alignment:
| Q |
8 |
aaatcatccatatttcttggtaattttctgaaccttaaaaacaactgtttnnnnnnnnnnnnnntccaatgatctcattcttcagtcatcatgtcaaaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5549497 |
aaatcatccatatttcttggtaattttctgaaccttaaaaacaactgtttaaaaagaaaaaaaatccaatgatctcattcttcagtcatcatgtcaaaat |
5549398 |
T |
 |
| Q |
108 |
ctgattggatgtgatataaaataaagtactaaaataatatatctaattttggaataactacaaaattattaaatattaagaaacccttttattaatttct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5549397 |
ctgattggatgtgatataaaataaagtactaaaataatatatctaattttggaatatctacaaaattataaaatattaagaaacccttttattaatttct |
5549298 |
T |
 |
| Q |
208 |
acaaatgatg |
217 |
Q |
| |
|
||| |||||| |
|
|
| T |
5549297 |
acacatgatg |
5549288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University