View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_17 (Length: 526)
Name: NF0821_high_17
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 29 - 333
Target Start/End: Original strand, 44119977 - 44120290
Alignment:
Q |
29 |
atcataaaacaacgtatcaattgtatcaactcacccaactacgtattttcatggaatataccttttttaagtccggcgtgcaacaatatcatgtgcagat |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
44119977 |
atcataaaacaacgtatcaattgtatcaactcacccaactacgtatttttatggaatataccttttttaagtctggcgtgcaacaatatcatgtgcagat |
44120076 |
T |
 |
Q |
129 |
aaatcattaatatttaatttactgtttaggccctcagcgtggtaagttgttgg--------atgaaattttcgaaaaaactattacctatccgaacattg |
220 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||| ||||||||||||||||||| |
|
|
T |
44120077 |
aaatcattaatatttaatttactgtttaggccctcagcgtgttaagttgttggatccacctataaaattttcgaaaaaaccattacctatccgaacattg |
44120176 |
T |
 |
Q |
221 |
tattagaccccatgaccactcatt-aactacacacataatcctgaccaatcttcgtgagaaccatcaccgcaacaatgccttaattttatctacgacttc |
319 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
44120177 |
tattagaccccatgaccactcattaaactacacacataatcctgaccaatcttcgtgagaaccatcaccgcaacaatgccttaattttatctatgacttc |
44120276 |
T |
 |
Q |
320 |
tctagcatgcgtag |
333 |
Q |
|
|
|||||||||||||| |
|
|
T |
44120277 |
tctagcatgcgtag |
44120290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6655 times since January 2019
Visitors: 5770