View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_30 (Length: 367)
Name: NF0821_high_30
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 10 - 320
Target Start/End: Complemental strand, 40001251 - 40000942
Alignment:
Q |
10 |
attatactc-atgtgtttattagatggattttcaataaaaactcatttgaataatgatttgatcatgggtttttgacgttgtttctaagtctatatagct |
108 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| ||| |
|
|
T |
40001251 |
attatactccatgtgtttattagatggattttcaataaaaactcatttgaataatgatttgaccatgggtttttgacgttgtttctaaatctata--gct |
40001154 |
T |
 |
Q |
109 |
ttgtatcattagtgattttttgatgaatgatggaatagaccgtactgtgtgcaaactaaattggccataattttccattttctcttttaactcagatatt |
208 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
T |
40001153 |
tcgtatcattagtgattttttgatgaatgatggaatagaccgtattgtgtgcaaactaaattagccataattttccattttctcttttaactcatatatt |
40001054 |
T |
 |
Q |
209 |
acaagagaatatgttgatttgaatatgtatctctgatgggaaattaatttgttatgtttgattcacaaactactccgaatctccaatttgattcccagaa |
308 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40001053 |
acaaaagaatatgttgatttgaatatgtatctctgatgggaaattaatttgttatgtttgattcacaaactactccgaatctccaatttgattcccagaa |
40000954 |
T |
 |
Q |
309 |
atatgaataggc |
320 |
Q |
|
|
|||||||||||| |
|
|
T |
40000953 |
atatgaataggc |
40000942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 127 times since January 2019
Visitors: 5777