View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_47 (Length: 310)
Name: NF0821_high_47
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_high_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 100 - 210
Target Start/End: Complemental strand, 28706680 - 28706569
Alignment:
Q |
100 |
gtcttagataggctccctattcgtgtgttccttg-ttataaacgagtcttgaatacggaggcctcgttgaattgtgttttctatgttggtggataagaga |
198 |
Q |
|
|
|||||||||||| |||||| ||||||| |||| ||||| |||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
T |
28706680 |
gtcttagataggatccctactcgtgtgaacctttcttatagacgagttttgaatacggaggccatgttgaactgtgttttctatgttggtggataagaga |
28706581 |
T |
 |
Q |
199 |
catcaattcacc |
210 |
Q |
|
|
||| |||||||| |
|
|
T |
28706580 |
cattaattcacc |
28706569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University