View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_51 (Length: 300)
Name: NF0821_high_51
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 7 - 287
Target Start/End: Original strand, 40317359 - 40317639
Alignment:
| Q |
7 |
cttttaatttgtaaccctaaattgataattgaattgaggactgttactgattatgattttttgcaggtttggaatgcctactcctacttcagctgccgat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40317359 |
cttttaatttgtaaccctaaattgataattgaattgaggactgttactgattatgattttttgcaggtttggaatgcctactcctacttcagctgccgat |
40317458 |
T |
 |
| Q |
107 |
gatgatgcaaaggagaaagctcgtcttgctaggtttgctgcaccgggttctaagaccaatcctgcggaagaagataaaaagaaagcaagagcacttaggt |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40317459 |
gatgatgcaaagaagaaagctcgtcttgctaggtttgctgcaccgggttctaagaccgatcctgcggaagaagataaaaagaaagcaagagcacttaggt |
40317558 |
T |
 |
| Q |
207 |
gtgtgtttcttgttgatatttgttttttccatttcataaggaattgtgtatgattggtaccttattaggttattgttttct |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
40317559 |
gtgtgtttcttgttgatatttgttttttccatttcataaggaattgtgtatgattggtatcttattagattattgttttct |
40317639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University