View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_56 (Length: 284)
Name: NF0821_high_56
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_high_56 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 49 - 284
Target Start/End: Original strand, 10258475 - 10258707
Alignment:
| Q |
49 |
tgatgatgtggaagaatcaatattgcaggattcatcttgctaccaagctgcagatcaagagtcttatttcggcgacgagggtgatagtgagaagaactcg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10258475 |
tgatgatgtggaagaatcaatattgcaggattcatcttgctaccaagctgcagatcaagagtcttatttcggcgacgagggtgatagtgagaagaactcg |
10258574 |
T |
|
| Q |
149 |
ttggctatggttccggtaaaagcaactgatgctggttctagcatgagaactttacatgacagagaagtaactgatttaaaacctggttggccactactac |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
10258575 |
ttggctatggttccggtaaaagcaactgatgctggttctagcatgagaactttacatgacagagaagtaactgctttaaaacctggttggccactactcc |
10258674 |
T |
|
| Q |
249 |
atcgtgcaatttcatcatcagacaagaaagtttctg |
284 |
Q |
| |
|
||||| ||||| || ||||||| ||||||||||| |
|
|
| T |
10258675 |
atcgtacaatt---tcgtcagacaggaaagtttctg |
10258707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 4 - 48
Target Start/End: Original strand, 51805613 - 51805657
Alignment:
| Q |
4 |
tgttgcaagttttttaacaatccaagttcttttggaatttgacct |
48 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51805613 |
tgttgcaagtttttcaacaatccaagttcttttggaatttgacct |
51805657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 90 times since January 2019
Visitors: 5777