View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_57 (Length: 284)
Name: NF0821_high_57
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_high_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 48 - 255
Target Start/End: Complemental strand, 52889604 - 52889397
Alignment:
| Q |
48 |
ggtttatttgttggtaactgagcttgatgggtttcaagtccatgattttagcatactaatcagtctgggtagattttgatatctatctttttagaaacca |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52889604 |
ggtttatttgttggtaactgagcttgatgggtttcaagtccatgattttagcatactaatcagtctgggtagattttgatatctatctttttagaaacca |
52889505 |
T |
|
| Q |
148 |
atcagcctgtcggtaaatgtatatcgttaatctcatactgtaaattatctttatatttgtttgtgatttattgtctcgtaacttcctttctcctatttac |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52889504 |
atcagcctgtcggtaaatgtatatcgttaatctcatactgtaaattatctttatatttgtttgtgatttattgtctcgtaacttcctttctcctatttac |
52889405 |
T |
|
| Q |
248 |
ataccagg |
255 |
Q |
| |
|
|||||||| |
|
|
| T |
52889404 |
ataccagg |
52889397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 52889604 - 52889571
Alignment:
| Q |
19 |
ggtttatttgttggtaactgagcttgatgggttt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52889604 |
ggtttatttgttggtaactgagcttgatgggttt |
52889571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 62 - 169
Target Start/End: Original strand, 47611134 - 47611241
Alignment:
| Q |
62 |
taactgagcttgatgggtttcaagtccatgattttagcatactaatcagtctgggtagattttgatatctatctttttagaaaccaatcagcctgtcggt |
161 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| | | |
|
|
| T |
47611134 |
taaccgagcttgatgggtttcaagtacatgattttagcatactaatcagtcttggtagattttgatatctgtctttttagaaaccaatcagcctgttgat |
47611233 |
T |
|
| Q |
162 |
aaatgtat |
169 |
Q |
| |
|
|||||||| |
|
|
| T |
47611234 |
aaatgtat |
47611241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6832 times since January 2019
Visitors: 5772