View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_58 (Length: 280)
Name: NF0821_high_58
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_high_58 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] scaffold0199 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 84; Significance: 6e-40; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 173 - 280
Target Start/End: Complemental strand, 1891298 - 1891191
Alignment:
| Q |
173 |
aagaagagatattggattactctcctccagagctgaaaggaggagctcgctcggatttgttaccgtagctgctgatccttttgggggagcaaatacggat |
272 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| || || ||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
1891298 |
aagaagagatgttggattactctcctccagagctgaaaggaggaggtcacttggatttgttaccgcagctgttgatccttttgggggagcaaatacggat |
1891199 |
T |
|
| Q |
273 |
ctcttggt |
280 |
Q |
| |
|
|||||||| |
|
|
| T |
1891198 |
ctcttggt |
1891191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 173 - 280
Target Start/End: Complemental strand, 1888086 - 1887979
Alignment:
| Q |
173 |
aagaagagatattggattactctcctccagagctgaaaggaggagctcgctcggatttgttaccgtagctgctgatccttttgggggagcaaatacggat |
272 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||||||||||||||| || |||||| | | | |||||||||||||||||||||||||||| | || |
|
|
| T |
1888086 |
aagaagagatgttggattactctcctctagaactgaaaggaggagctcacttggatttttctctgcggctgctgatccttttgggggagcaaatatgaat |
1887987 |
T |
|
| Q |
273 |
ctcttggt |
280 |
Q |
| |
|
|||||||| |
|
|
| T |
1887986 |
ctcttggt |
1887979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 173 - 280
Target Start/End: Original strand, 1670401 - 1670508
Alignment:
| Q |
173 |
aagaagagatattggattactctcctccagagctgaaaggaggagctcgctcggatttgttaccgtagctgctgatccttttgggggagcaaatacggat |
272 |
Q |
| |
|
|||||||||| ||||||||||| || ||| |||||||||||||||| || |||||| | | | |||||||||||||||||||||||||||||| || |
|
|
| T |
1670401 |
aagaagagatgttggattactccgctgtagaactgaaaggaggagctcacttggatttttctctgcggctgctgatccttttgggggagcaaatacgaat |
1670500 |
T |
|
| Q |
273 |
ctcttggt |
280 |
Q |
| |
|
|||||||| |
|
|
| T |
1670501 |
ctcttggt |
1670508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 173 - 280
Target Start/End: Complemental strand, 5996916 - 5996809
Alignment:
| Q |
173 |
aagaagagatattggattactctcctccagagctgaaaggaggagctcgctcggatttgttaccgtagctgctgatccttttgggggagcaaatacggat |
272 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||| || ||||||||| ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
5996916 |
aagaagagatgttggattactctcctccagagctgaaaggaggtgctcacttggatttgtttccgcagctgctgatccttttgggggagcaaatatggat |
5996817 |
T |
|
| Q |
273 |
ctcttggt |
280 |
Q |
| |
|
|||||||| |
|
|
| T |
5996816 |
ctcttggt |
5996809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 171 - 280
Target Start/End: Original strand, 8292 - 8401
Alignment:
| Q |
171 |
caaagaagagatattggattactctcctccagagctgaaaggaggagctcgctcggatttgttaccgtagctgctgatccttttgggggagcaaatacgg |
270 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| |||||||||||||||| || |||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
8292 |
caaagaagagatgttgggttactcttctccagaactgaaaggaggagctcacttggatttttctccgcggctgctgatccttttgggggagcaaatacga |
8391 |
T |
|
| Q |
271 |
atctcttggt |
280 |
Q |
| |
|
|||| ||||| |
|
|
| T |
8392 |
atctattggt |
8401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6964 times since January 2019
Visitors: 5773