View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_66 (Length: 261)
Name: NF0821_high_66
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_high_66 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 7589826 - 7589589
Alignment:
| Q |
16 |
ataggaaaaggaagtatgagcaatgattttcccacgattccattagcatcttggtccacatcaaacatacatagaataaataattttccaagtttgtaat |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7589826 |
ataggtaaaggaagtatgagcaatgattttcccacgattccattagcatcttggtccacatcaaacatacatagaataaataattttccaagtttgtaat |
7589727 |
T |
|
| Q |
116 |
ataaaaatagagtatctattcttaattttttatcagttgagtaagtgtgtggagagtgatcagtgatgtataagcatttcagttagcagatattattatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7589726 |
ataaaaatagagtatctattcttaattttttatcagttgagtaagtgtgtggagagagatcagtgatgtataagcatttcagttagcagatattattatc |
7589627 |
T |
|
| Q |
216 |
aatttatatcaggttatcaattaggtctgtgcgtgaca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7589626 |
aatttatatcaggttatcaattaggtctgtgcgtgaca |
7589589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 166 times since January 2019
Visitors: 5777