View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_73 (Length: 251)
Name: NF0821_high_73
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_high_73 |
 |  |
|
[»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 12 - 251
Target Start/End: Original strand, 16102103 - 16102342
Alignment:
Q |
12 |
atgaatgagttaacaaacatataggcaggtacatgtagcaaaacgtgggtcaatactagcatcacaatacccagttccagcttggtatgtactagaacat |
111 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
T |
16102103 |
atgaatgagttaacaaacatataggcaggtacatgtagcaaaacgtgggtcaatactagcatcacaatacccagtaccagcttggtatctactagaacat |
16102202 |
T |
 |
Q |
112 |
ttgtcattgcaactagggctaccaccgttatcacaaaaaccaagattaacctcacaatccctttttggtgcttttttacctggtttccctccacaagtga |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
16102203 |
ttgtcattgcaactagggctaccaccgttatcacaaaaaccaagattaacctcacaatccctttttggtgcttttttacctggcttccctccacaagtga |
16102302 |
T |
 |
Q |
212 |
aattacaaatgcatttttcattggcacaaattccatttcc |
251 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
16102303 |
aattacaaatgcatctttcattggcacaaattccatttcc |
16102342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 165 - 251
Target Start/End: Original strand, 16138081 - 16138167
Alignment:
Q |
165 |
acaatccctttttggtgcttttttacctggtttccctccacaagtgaaattacaaatgcatttttcattggcacaaattccatttcc |
251 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||| |||||| ||| |||| |
|
|
T |
16138081 |
acaatccctttttggtgcttttttacctgccttccctccacattcgaaattacaaatgcatctttcattgctacaaatcccaattcc |
16138167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 165 - 234
Target Start/End: Original strand, 16116863 - 16116932
Alignment:
Q |
165 |
acaatccctttttggtgcttttttacctggtttccctccacaagtgaaattacaaatgcatttttcattg |
234 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
T |
16116863 |
acaatccctttttggtgcttttttacctgccttccctccacattcgaaattacaaatgcatctttcattg |
16116932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University