View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_78 (Length: 239)
Name: NF0821_high_78
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_high_78 |
 |  |
|
[»] scaffold1463 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 17833846 - 17834013
Alignment:
Q |
1 |
tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgaggttggagaatgtgttccttacatgtgcaatgctgctta |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
T |
17833846 |
tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgagggtggagaatgtgttccttacatgtgcagtgctgctta |
17833945 |
T |
 |
Q |
101 |
acatttgatgatttagttttaccaagcctttgagattaacattggaatatgtggtcatctgtgctgct |
168 |
Q |
|
|
|||| ||||| |||||||||| ||||||| |||||||||||||||||||||||||||| |||| |||| |
|
|
T |
17833946 |
acatgtgatggtttagttttagcaagcctctgagattaacattggaatatgtggtcatttgtgttgct |
17834013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1463 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: scaffold1463
Description:
Target: scaffold1463; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 729 - 838
Alignment:
Q |
1 |
tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgaggttggagaatgtgttccttacatgtgcaatgctgctta |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | | |||||||| ||||| || |||||| |
|
|
T |
729 |
tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgagggtggagaacgggatccttacacgtgcagtgttgctta |
828 |
T |
 |
Q |
101 |
acatttgatg |
110 |
Q |
|
|
|||||||||| |
|
|
T |
829 |
acatttgatg |
838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 50231503 - 50231394
Alignment:
Q |
1 |
tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgaggttggagaatgtgttccttacatgtgcaatgctgctta |
100 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||| ||||| | ||||||| |
|
|
T |
50231503 |
tcatgcagatttctatcgaggcatttcctcaaaattgttgcaaatttatcttggtggatgagggtggagaacgggttccttacacgtgcagttctgctta |
50231404 |
T |
 |
Q |
101 |
acatttgatg |
110 |
Q |
|
|
|||||||||| |
|
|
T |
50231403 |
acatttgatg |
50231394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6605 times since January 2019
Visitors: 5769