View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_80 (Length: 225)
Name: NF0821_high_80
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_high_80 |
 | |
|
| [»] scaffold1463 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 17833846 - 17834021
Alignment:
| Q |
1 |
tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgaggttggagaatgtgttccttacatgtgcaatgctgctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17833846 |
tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgagggtggagaatgtgttccttacatgtgcagtgctgctta |
17833945 |
T |
|
| Q |
101 |
acatttgatgatttagttttaccaagcctttgagattaacattggaatatgtggtcatttgtgttgctgaagggat |
176 |
Q |
| |
|
|||| ||||| |||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17833946 |
acatgtgatggtttagttttagcaagcctctgagattaacattggaatatgtggtcatttgtgttgctgaagggat |
17834021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1463 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: scaffold1463
Description:
Target: scaffold1463; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 729 - 838
Alignment:
| Q |
1 |
tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgaggttggagaatgtgttccttacatgtgcaatgctgctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | | |||||||| ||||| || |||||| |
|
|
| T |
729 |
tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgagggtggagaacgggatccttacacgtgcagtgttgctta |
828 |
T |
|
| Q |
101 |
acatttgatg |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
829 |
acatttgatg |
838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 50231503 - 50231394
Alignment:
| Q |
1 |
tcatgcagatttctattgaggcatttcctcaaaattgttgcaaatttatcttggtggatgaggttggagaatgtgttccttacatgtgcaatgctgctta |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||| ||||| | ||||||| |
|
|
| T |
50231503 |
tcatgcagatttctatcgaggcatttcctcaaaattgttgcaaatttatcttggtggatgagggtggagaacgggttccttacacgtgcagttctgctta |
50231404 |
T |
|
| Q |
101 |
acatttgatg |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
50231403 |
acatttgatg |
50231394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 68 times since January 2019
Visitors: 5776