View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0821_high_82 (Length: 218)

Name: NF0821_high_82
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0821_high_82
NF0821_high_82
[»] chr1 (1 HSPs)
chr1 (1-108)||(38304337-38304444)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 38304337 - 38304444
Alignment:
1 tccatggtttcttccacccatcttcaccacacactcctctttcctcacaccttgtcaatgcttacgttaactttggttcccaccattacgcttttctctc 100  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
38304337 tccatggtttcttccacccatcttcaccacacactcctctttgctcacaccttgtcaatgcttacgttaactttggttcccaccattacgcttttctctt 38304436  T
101 cttctctc 108  Q
    ||||||||    
38304437 cttctctc 38304444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 7164 times since January 2019
Visitors: 5775