View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_high_84 (Length: 207)
Name: NF0821_high_84
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_high_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 38304444 - 38304272
Alignment:
Q |
17 |
gagagaaggagagaaaagcgtaatggtgggaaccaaagttaacgtaagcattgacaaggtgtgaggaaagaggagtgtgtggtgaagatgggtggaagaa |
116 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
38304444 |
gagagaagaagagaaaagcgtaatggtgggaaccaaagttaacgtaagcattgacaaggtgtgagcaaagaggagtgtgtggtgaagatgggtggaagaa |
38304345 |
T |
 |
Q |
117 |
accatggatgagaagaagagcgtggagttttttggtttggagaagatttggtggagatttgaggtgatggagg |
189 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38304344 |
accatggatgagaagaagagcgtggagttttttggtttggagaagatttggtggagatttgaggtgatggagg |
38304272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University