View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0821_high_90 (Length: 202)

Name: NF0821_high_90
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0821_high_90
NF0821_high_90
[»] chr1 (1 HSPs)
chr1 (1-108)||(4124313-4124423)


Alignment Details
Target: chr1 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 4124313 - 4124423
Alignment:
1 cgtggtggtttgttgtcgaggtcccagaggacacagactttgttctgtttttgttcgtaggttccttgtttggtttttaccatgtcgat---gtcgatta 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||    
4124313 cgtggtggtttgttgtcgaggtcccagaggacacagactttgttctgtttttgttcgtaggttccttgtttggtttttaccatgtcgatgtcgtcgatta 4124412  T
98 tgttgttgttg 108  Q
    |||||||||||    
4124413 tgttgttgttg 4124423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 7076 times since January 2019
Visitors: 5774