View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_104 (Length: 218)
Name: NF0821_low_104
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_low_104 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 38304337 - 38304444
Alignment:
Q |
1 |
tccatggtttcttccacccatcttcaccacacactcctctttcctcacaccttgtcaatgcttacgttaactttggttcccaccattacgcttttctctc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38304337 |
tccatggtttcttccacccatcttcaccacacactcctctttgctcacaccttgtcaatgcttacgttaactttggttcccaccattacgcttttctctt |
38304436 |
T |
 |
Q |
101 |
cttctctc |
108 |
Q |
|
|
|||||||| |
|
|
T |
38304437 |
cttctctc |
38304444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6942 times since January 2019
Visitors: 5773