View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0821_low_109 (Length: 205)

Name: NF0821_low_109
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0821_low_109
NF0821_low_109
[»] chr3 (1 HSPs)
chr3 (2-88)||(40809908-40809994)


Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 2 - 88
Target Start/End: Original strand, 40809908 - 40809994
Alignment:
2 ttgctgaaacaacaacaacatgctccctacatcccagttcccttctcccttgattctcagtttcagattaactcaattattgtcctt 88  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40809908 ttgctgaaacaacaacaacatgctccctacatcccagttcccttctcccttgattctcagtttcagattaactcaattattgtcctt 40809994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University