View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_113 (Length: 202)
Name: NF0821_low_113
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_low_113 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 4124313 - 4124423
Alignment:
| Q |
1 |
cgtggtggtttgttgtcgaggtcccagaggacacagactttgttctgtttttgttcgtaggttccttgtttggtttttaccatgtcgat---gtcgatta |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4124313 |
cgtggtggtttgttgtcgaggtcccagaggacacagactttgttctgtttttgttcgtaggttccttgtttggtttttaccatgtcgatgtcgtcgatta |
4124412 |
T |
 |
| Q |
98 |
tgttgttgttg |
108 |
Q |
| |
|
||||||||||| |
|
|
| T |
4124413 |
tgttgttgttg |
4124423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University