View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_15 (Length: 573)
Name: NF0821_low_15
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_low_15 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 515; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 515; E-Value: 0
Query Start/End: Original strand, 30 - 573
Target Start/End: Complemental strand, 31692017 - 31691474
Alignment:
| Q |
30 |
caagttcctttgatatgtctatctcttccgtggcctcctttaacttttttcttgtgttttccaatttgaatgaaaactcatttgcttctctttctctttg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31692017 |
caagttcctttgatatgtctatctcttccgtggcctcctttaacgtttttcttgtgttttccaatttgaatgaaaactcatttgcttctctttctctttg |
31691918 |
T |
|
| Q |
130 |
aactctaatatcctccaactctttcaaagcctcaatcctggccaattcagcaagtacttgttcttcattggcttcttcaatctcctttctaagtacttct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31691917 |
aactctaatatcctccaactctttcaaagcctcaatcctggccaattcagcaagtacttgttcttcattggcttcttcaatctcctttctaagtacttct |
31691818 |
T |
|
| Q |
230 |
tcnnnnnnngaacaatcaatcatctttgagcttgatgcttcgatttctttctcggcccgcgatttctcttgcaaaacagaagccacgtcaagctttagct |
329 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31691817 |
tctttttttgaacaatcaatcatctttgagcttgatgcttcgatttctttctcggcccgcgatttctcttgcaaaacagaagccacgtcaagctttagct |
31691718 |
T |
|
| Q |
330 |
taaacaattcctttttgagatattccaattctctcatcacttgtgcatactcataattctcattcctccttacaaccatagcaccatgttgaccttttcc |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31691717 |
taaacaattcctttttgagatattccaattctctcatcacttgtgcatactcataattctcattcctccttacaaccataacaccatgttgaccttttcc |
31691618 |
T |
|
| Q |
430 |
cttcttctctagtgtttctatgtccttcattttcgccttagccttgtaacttgattcctcaatcatagaagagagatttttcattgtctttttagcattt |
529 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31691617 |
cttcttctctagtgtttctatgtccttcattttcgccttagccttgtaacttgattcctcaatcatagaagagagatttttcattgtctttttagcattt |
31691518 |
T |
|
| Q |
530 |
gaaagctcagattctgcttgagattttgcagattctgctgtcca |
573 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31691517 |
gaaagctcagattctgcttgagattttgcagattctgctgtcca |
31691474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6368 times since January 2019
Visitors: 5767