View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_44 (Length: 366)
Name: NF0821_low_44
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 29 - 353
Target Start/End: Original strand, 36276990 - 36277314
Alignment:
Q |
29 |
acaacttggttacaaactaggacaaaaaccaaactataagagcacgattatgaaagcaagactgcaactttgaagaaagtgtccccctccaaaaaacacc |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36276990 |
acaacttggttacaaactaggacaaaaaccaaactataagagcacaattatgaaagcaagactgcaactttgaagaaagtgtccccctccaaaaaacacc |
36277089 |
T |
 |
Q |
129 |
cttaatagctaaacttattttgtgcaactttagctataaatagcattagcacgtacaatcacttttagtttatggttttaatcaatttcaacgtcttctg |
228 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36277090 |
ctaaatagctaaacttattttgtgcaactttagctataaatagcattagcacgtacaatcacttttagtttatggttttaatcaatttcaacgtcttctg |
36277189 |
T |
 |
Q |
229 |
gcagctgtttctctttgtgcattgnnnnnnncagcagccacaggaggcccgaggtcattgtcttgtgcaaatttccttgtgttaaagagatctcttgatg |
328 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
36277190 |
gcagctgtttctctttgtgcattgaaaaaaacagcagccacaggaggcccgaggtcattgtcttgtgcaaatttctttgtgttaaagagatctcttgatg |
36277289 |
T |
 |
Q |
329 |
ttggtattttcatcactgtctgtct |
353 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
36277290 |
ttggtattttcatcactgtctgtct |
36277314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University