View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_47 (Length: 338)
Name: NF0821_low_47
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 96 - 320
Target Start/End: Complemental strand, 11331036 - 11330811
Alignment:
| Q |
96 |
ttccttgtatcgatttctattgactacatgatttaaaccattcaaatataaagcttgaagaatctaaatgagattatgtacattcattaccgagaaagtg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11331036 |
ttccttgtatcgatttctattgactacatgatttaaaccaatcaaatataaagcttgaagaatctaaatgagattatgtacattcattatcgagaaagtg |
11330937 |
T |
|
| Q |
196 |
cctatcatctaactagttggttggaacacaaataagtgactagcaagcaaaacaata-nnnnnnnatgatgcctgaaaacaagtagaagagctagcaata |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11330936 |
cctatcatctaactagttggttggaacacaaataagcgactagcaagcaaaacaatattttttttatgatgcctgaaaacaagtagaagagctagcaata |
11330837 |
T |
|
| Q |
295 |
tttacttactatcaattgtcttcatc |
320 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
11330836 |
tttacttactatcaattgtctccatc |
11330811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 260 - 315
Target Start/End: Original strand, 7178030 - 7178085
Alignment:
| Q |
260 |
atgatgcctgaaaacaagtagaagagctagcaatatttacttactatcaattgtct |
315 |
Q |
| |
|
||||||||| || |||||| ||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
7178030 |
atgatgcctaaatacaagtggaaaagctaacaatatttacttactatcaattgtct |
7178085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7242 times since January 2019
Visitors: 5775