View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0821_low_60 (Length: 310)

Name: NF0821_low_60
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0821_low_60
NF0821_low_60
[»] chr6 (1 HSPs)
chr6 (100-210)||(28706569-28706680)


Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 100 - 210
Target Start/End: Complemental strand, 28706680 - 28706569
Alignment:
100 gtcttagataggctccctattcgtgtgttccttg-ttataaacgagtcttgaatacggaggcctcgttgaattgtgttttctatgttggtggataagaga 198  Q
    |||||||||||| |||||| |||||||  ||||  ||||| |||||| |||||||||||||||  |||||| ||||||||||||||||||||||||||||    
28706680 gtcttagataggatccctactcgtgtgaacctttcttatagacgagttttgaatacggaggccatgttgaactgtgttttctatgttggtggataagaga 28706581  T
199 catcaattcacc 210  Q
    ||| ||||||||    
28706580 cattaattcacc 28706569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University