View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_64 (Length: 303)
Name: NF0821_low_64
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_low_64 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 30 - 303
Target Start/End: Original strand, 32668882 - 32669155
Alignment:
| Q |
30 |
tgaatccccaaatctgaaacaaattcgcctgcttcagtttcttccccgaagataacgaatctcgttctggcgtcaacagagaggaacaatcggatccgca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32668882 |
tgaatccccaaatctgaaacaaattcgcctgcttcagtttcttccccgaagataacgaatctcgttctggcgtcaacagagaggaacaatcggatccgca |
32668981 |
T |
 |
| Q |
130 |
gcggtagaaatcggcggcgaaactgcttttctccgacccgtttggcgaaggggattcgattgggggttgttgtgaggggaagccttcgtcgtcgagtcga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32668982 |
gcggtagaaatcggcggcgaaactgcttttctccgacccgtttggcgaaggggattcgattgggagttgttgtgaggggaagccttcgtcgtcgagtcga |
32669081 |
T |
 |
| Q |
230 |
atggcatcgaacgaagcgtcatcgtcgttgacgttgtaagagtcaccgtcgtcgtgatgtaaggttccggcttc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32669082 |
atggcatcgaacgaagcgtcatcgtcgttgacgttgtaagagtcaccgtcgtcgtgatgtaaggttccggcttc |
32669155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 30 - 90
Target Start/End: Complemental strand, 48664754 - 48664694
Alignment:
| Q |
30 |
tgaatccccaaatctgaaacaaattcgcctgcttcagtttcttccccgaagataacgaatc |
90 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
48664754 |
tgaatccccaaatctggaacagattggcctgcttaagtttcttccccgaagataacgaatc |
48664694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University