View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_66 (Length: 301)
Name: NF0821_low_66
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 50 - 285
Target Start/End: Complemental strand, 26878967 - 26878730
Alignment:
| Q |
50 |
aaacttgtctatggagtaacaaagtagtaccttgttgatggtcaccttgagtgattaatgttgcataatcatgcactgaaagtgaatggttcatattgta |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
26878967 |
aaacttgtctatggagtaacaaagtagtaccttgttgatggtcaccttgagtgattaatgttgcataatcatgcagtgaaagtgaatggttcaaattgta |
26878868 |
T |
 |
| Q |
150 |
tttatattgtgtatgcattcagacaccctctaagagtttgctctcaagagtgttc--cacttctgagattttggagtttttggtagtgtgtcctttaggt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26878867 |
tttatattgtgtatgcattcagacaccctctaagagtttgctctcaagagtgtcccacacttctgagattttggagtttttggtagtgtgtcctttagat |
26878768 |
T |
 |
| Q |
248 |
ccaatacaccaattagggtggcctattttccctttagg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26878767 |
ccaatacaccaattagggtggcctattttccctttagg |
26878730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 51805668 - 51805618
Alignment:
| Q |
6 |
aatttcctcacaggtcaaattccaaaagaacttggattgctgaaaaacttg |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51805668 |
aatttcctcacaggtcaaattccaaaagaacttggattgttgaaaaacttg |
51805618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University