View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_71 (Length: 286)
Name: NF0821_low_71
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 52 - 219
Target Start/End: Original strand, 4687233 - 4687397
Alignment:
Q |
52 |
ataaggtgtgcggtaaagttgtatagttactccatagtccttcacaaataatataccaacaccaactgttatcactctttaatagctgatattaaattgc |
151 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
T |
4687233 |
ataaggtgtgcggtaaagttgtatagttactccatagtcctgcacaaata---taccaacaccaactgttatcactctttaatagccgatattaaatttc |
4687329 |
T |
 |
Q |
152 |
atttgcatcgcatggaaatgtttcacaaaccactaacaaacaacataatgcaaaactagagctgtcaa |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
4687330 |
atttgcatcgcatggaaatgtttcacaaaccactgacaaacaacataatgcaaaactagagctgtcaa |
4687397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6593 times since January 2019
Visitors: 5769