View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0821_low_75 (Length: 280)

Name: NF0821_low_75
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0821_low_75
NF0821_low_75
[»] chr8 (3 HSPs)
chr8 (173-280)||(1891191-1891298)
chr8 (173-280)||(1887979-1888086)
chr8 (173-280)||(1670401-1670508)
[»] chr2 (1 HSPs)
chr2 (173-280)||(5996809-5996916)
[»] scaffold0199 (1 HSPs)
scaffold0199 (171-280)||(8292-8401)


Alignment Details
Target: chr8 (Bit Score: 84; Significance: 6e-40; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 173 - 280
Target Start/End: Complemental strand, 1891298 - 1891191
Alignment:
173 aagaagagatattggattactctcctccagagctgaaaggaggagctcgctcggatttgttaccgtagctgctgatccttttgggggagcaaatacggat 272  Q
    |||||||||| |||||||||||||||||||||||||||||||||| || || ||||||||||||| ||||| ||||||||||||||||||||||||||||    
1891298 aagaagagatgttggattactctcctccagagctgaaaggaggaggtcacttggatttgttaccgcagctgttgatccttttgggggagcaaatacggat 1891199  T
273 ctcttggt 280  Q
    ||||||||    
1891198 ctcttggt 1891191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 173 - 280
Target Start/End: Complemental strand, 1888086 - 1887979
Alignment:
173 aagaagagatattggattactctcctccagagctgaaaggaggagctcgctcggatttgttaccgtagctgctgatccttttgggggagcaaatacggat 272  Q
    |||||||||| |||||||||||||||| ||| |||||||||||||||| || |||||| |  | |  |||||||||||||||||||||||||||| | ||    
1888086 aagaagagatgttggattactctcctctagaactgaaaggaggagctcacttggatttttctctgcggctgctgatccttttgggggagcaaatatgaat 1887987  T
273 ctcttggt 280  Q
    ||||||||    
1887986 ctcttggt 1887979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 173 - 280
Target Start/End: Original strand, 1670401 - 1670508
Alignment:
173 aagaagagatattggattactctcctccagagctgaaaggaggagctcgctcggatttgttaccgtagctgctgatccttttgggggagcaaatacggat 272  Q
    |||||||||| |||||||||||  ||  ||| |||||||||||||||| || |||||| |  | |  |||||||||||||||||||||||||||||| ||    
1670401 aagaagagatgttggattactccgctgtagaactgaaaggaggagctcacttggatttttctctgcggctgctgatccttttgggggagcaaatacgaat 1670500  T
273 ctcttggt 280  Q
    ||||||||    
1670501 ctcttggt 1670508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 173 - 280
Target Start/End: Complemental strand, 5996916 - 5996809
Alignment:
173 aagaagagatattggattactctcctccagagctgaaaggaggagctcgctcggatttgttaccgtagctgctgatccttttgggggagcaaatacggat 272  Q
    |||||||||| |||||||||||||||||||||||||||||||| |||| || ||||||||| ||| ||||||||||||||||||||||||||||| ||||    
5996916 aagaagagatgttggattactctcctccagagctgaaaggaggtgctcacttggatttgtttccgcagctgctgatccttttgggggagcaaatatggat 5996817  T
273 ctcttggt 280  Q
    ||||||||    
5996816 ctcttggt 5996809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0199 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0199
Description:

Target: scaffold0199; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 171 - 280
Target Start/End: Original strand, 8292 - 8401
Alignment:
171 caaagaagagatattggattactctcctccagagctgaaaggaggagctcgctcggatttgttaccgtagctgctgatccttttgggggagcaaatacgg 270  Q
    |||||||||||| |||| ||||||| ||||||| |||||||||||||||| || |||||| |  |||  ||||||||||||||||||||||||||||||     
8292 caaagaagagatgttgggttactcttctccagaactgaaaggaggagctcacttggatttttctccgcggctgctgatccttttgggggagcaaatacga 8391  T
271 atctcttggt 280  Q
    |||| |||||    
8392 atctattggt 8401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 128 times since January 2019
Visitors: 5777