View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_80 (Length: 264)
Name: NF0821_low_80
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_low_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 133 - 244
Target Start/End: Complemental strand, 1430882 - 1430767
Alignment:
Q |
133 |
cgaaaaacatatagggtgggaaaataatttcaaatcaagttttattaataatgtatca----aacttggcaaattttaaagagaatttatttttatgtcc |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
T |
1430882 |
cgaaaaacatatagggtgggaaaataatttcaaatcaagttttattaataatgtatcaaattaacttggcaaattttaaagagaatttctttttatgtcc |
1430783 |
T |
 |
Q |
229 |
cctcaatatctctgtg |
244 |
Q |
|
|
|||||||||||||||| |
|
|
T |
1430782 |
cctcaatatctctgtg |
1430767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 38 - 94
Target Start/End: Complemental strand, 1430950 - 1430894
Alignment:
Q |
38 |
tttatgaggttttaaattgtataatccaaaaatccataggggttcagattatattat |
94 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1430950 |
tttatgaggtttcaaattgtataatccaaaaatccataggggttcagattatattat |
1430894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University