View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_82 (Length: 262)
Name: NF0821_low_82
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 30 - 254
Target Start/End: Original strand, 38053353 - 38053577
Alignment:
| Q |
30 |
tggtttgcataaggtcatttcaactcactcaaaaagcatctaagatggaatacaaagcaattgagagtgtgcttcaaactattaatcctcattccggcga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38053353 |
tggtttgcataaggtcatttcaactcactcaaaaagcatctaagatggaatacaaagcaattgagagtgtgcttcaaactattaatcctcattccggcga |
38053452 |
T |
 |
| Q |
130 |
ggtatcactcttcttgggtatttttagcataaggtcattccagcttaagcaaaaaacactcgtttggccactgccattttatcagacttataacttattt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||| ||||||||||| |
|
|
| T |
38053453 |
ggtatcactcttcttgggtatttttagcataaggtcattccagcttaagcaaaaaacactcgtttggtcactgtcattttttcagactcataacttattt |
38053552 |
T |
 |
| Q |
230 |
tcactgccttatagcttaagcatat |
254 |
Q |
| |
|
||||| ||||||||||||| ||||| |
|
|
| T |
38053553 |
tcactaccttatagcttaaacatat |
38053577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University