View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_86 (Length: 258)
Name: NF0821_low_86
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_low_86 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 28 - 258
Target Start/End: Original strand, 4149302 - 4149532
Alignment:
| Q |
28 |
caaaatatgtaagccaaatgcaacaacaacaaccagaaataactcaattatcaaaaaacttacaatcatagtatcgattctcgagagtgttatacccaat |
127 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4149302 |
caaaatctgtaagccagatgcaacaacaacaaccagaaataactcaattatgaaaaaacttacattcatagtatcgattctcgagagtgttatacccaat |
4149401 |
T |
 |
| Q |
128 |
agcttgagcaacatcaatcggcttcccaggaggataaggcctttgccaaaacccccaaatccccaaataaaattgtctagcaaaatcccaaaacttatct |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4149402 |
agcttgagcaacatcaatcggcttcccaggaggataaggcctttgccaaaacccccaaatccccaaataaaattgtctagcaaaatcccaaaacttatct |
4149501 |
T |
 |
| Q |
228 |
tgcgctgcataccgtgactgcgcttttctcg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4149502 |
tgcgctgcataccgtgactgcgcttttctcg |
4149532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University