View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_92 (Length: 251)
Name: NF0821_low_92
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0821_low_92 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 21 - 251
Target Start/End: Complemental strand, 8418803 - 8418572
Alignment:
| Q |
21 |
aaaattaattctaagtcttcataatccctttttggctctcctaaaatgaatctaaacctagactttgattcagacatggtgcatgtacaaaagtgatttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8418803 |
aaaattaattctaagtcttcataatccctttttggctctcctaaaatgaatctaaacctagactttgattcacacatggtgcatgtacaaaagtgatttt |
8418704 |
T |
|
| Q |
121 |
atgagcgtaaaattgattttaaaatgtttaaatgttctttgctataatagtttttgttttcaaaatgctcttaaatttatttttcaatttac-atatata |
219 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |||| | |||| |
|
|
| T |
8418703 |
atgtgcgtaaaattgagtttaaaatgtttaaatgttctatgctataatagtttttgttttcaaaatgctctaaaatttatttttcaacttactacttata |
8418604 |
T |
|
| Q |
220 |
cgtgattatattaaaacataaataattgtata |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
8418603 |
ggtgattattttaaaacataaataattgtata |
8418572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5570 times since January 2019
Visitors: 5757