View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_95 (Length: 249)
Name: NF0821_low_95
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_low_95 |
 |  |
|
[»] scaffold0168 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 53 - 178
Target Start/End: Original strand, 36277746 - 36277871
Alignment:
Q |
53 |
ttcagcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggacgtaatttgtaattttttaaagttgtctattatagacatttgt |
152 |
Q |
|
|
|||| ||||||||||||||||||||||||| || ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36277746 |
ttcaacccctacatataacaatgcatgtcactgccaactgagctatgctcacggggacgtaatttgtaattttttaaagttgtctattatagacatttgt |
36277845 |
T |
 |
Q |
153 |
tccgttaaaatatgagttattgaaag |
178 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
36277846 |
tccgttaaaatatgagttattgaaag |
36277871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 109
Target Start/End: Complemental strand, 28979072 - 28979021
Alignment:
Q |
58 |
cccctacatataacaatgcatgtcagtgtcaattgaactatgctcacgggga |
109 |
Q |
|
|
|||||||||||||||||||||||| | |||| ||||||||||||||||||| |
|
|
T |
28979072 |
cccctacatataacaatgcatgtccctatcaactgaactatgctcacgggga |
28979021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 111
Target Start/End: Original strand, 14011086 - 14011140
Alignment:
Q |
57 |
gcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggacg |
111 |
Q |
|
|
|||||| |||||||||||||||||| || ||| |||||||||||||| |||||| |
|
|
T |
14011086 |
gcccctgcatataacaatgcatgtccctgccaactgaactatgctcacagggacg |
14011140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 111
Target Start/End: Complemental strand, 18123899 - 18123853
Alignment:
Q |
65 |
atataacaatgcatgtcagtgtcaattgaactatgctcacggggacg |
111 |
Q |
|
|
||||||||||| || || |||||||||||||||||||||||||||| |
|
|
T |
18123899 |
atataacaatgtatatccctgtcaattgaactatgctcacggggacg |
18123853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 117
Target Start/End: Complemental strand, 36045876 - 36045817
Alignment:
Q |
58 |
cccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggacgtaattt |
117 |
Q |
|
|
||||| |||||||||||||||||| |||||||||| |||||||||| ||||| |||||| |
|
|
T |
36045876 |
cccctgcatataacaatgcatgtccctgtcaattgagctatgctcactgggacataattt |
36045817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 59 - 93
Target Start/End: Original strand, 9302693 - 9302727
Alignment:
Q |
59 |
ccctacatataacaatgcatgtcagtgtcaattga |
93 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| |
|
|
T |
9302693 |
ccctacatataacaatgcatgtccgtgtcaattga |
9302727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 110
Target Start/End: Complemental strand, 30616044 - 30615991
Alignment:
Q |
58 |
cccctacatataacaatgcat-gtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
||||| ||||||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
T |
30616044 |
cccctgcatataacaatgcattgtccatgtcaattgagctatgctcacggggac |
30615991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 56 - 109
Target Start/End: Original strand, 35813289 - 35813342
Alignment:
Q |
56 |
agcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacgggga |
109 |
Q |
|
|
||||||| |||||||||||||||||| |||||| ||| ||||||||||||||| |
|
|
T |
35813289 |
agcccctgcatataacaatgcatgtccctgtcaactgagctatgctcacgggga |
35813342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 58 - 110
Target Start/End: Complemental strand, 13862171 - 13862119
Alignment:
Q |
58 |
cccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
||||| ||||||||||||||| || |||||| |||||||||||||||||||| |
|
|
T |
13862171 |
cccctgcatataacaatgcatatccatgtcaactgaactatgctcacggggac |
13862119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 110
Target Start/End: Original strand, 42553190 - 42553241
Alignment:
Q |
59 |
ccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||| |||||||||||||||||| |||||| ||| |||||||||||||||| |
|
|
T |
42553190 |
ccctgcatataacaatgcatgtcgttgtcaactgagctatgctcacggggac |
42553241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 110
Target Start/End: Complemental strand, 28537175 - 28537129
Alignment:
Q |
64 |
catataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
T |
28537175 |
catataacaatgcatgtccatgtcaattgagttatgctcacggggac |
28537129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 3535992 - 3536037
Alignment:
Q |
65 |
atataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
||||||||||||||||| || ||| |||||||||||||||||||| |
|
|
T |
3535992 |
atataacaatgcatgtccctgccaactgaactatgctcacggggac |
3536037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 64 - 104
Target Start/End: Original strand, 41405143 - 41405183
Alignment:
Q |
64 |
catataacaatgcatgtcagtgtcaattgaactatgctcac |
104 |
Q |
|
|
|||||||||||||||||| |||||| |||||||||||||| |
|
|
T |
41405143 |
catataacaatgcatgtccctgtcaactgaactatgctcac |
41405183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 110
Target Start/End: Original strand, 9443516 - 9443564
Alignment:
Q |
62 |
tacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||||||||||||||||||| || |||| ||| |||||||||||||||| |
|
|
T |
9443516 |
tacatataacaatgcatgtccgtatcaactgagctatgctcacggggac |
9443564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 110
Target Start/End: Complemental strand, 8176041 - 8175990
Alignment:
Q |
59 |
ccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||| |||||||||||||||||| |||||| ||| |||||||||||||||| |
|
|
T |
8176041 |
ccctgcatataacaatgcatgtctctgtcaactgagctatgctcacggggac |
8175990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 110
Target Start/End: Complemental strand, 10455789 - 10455736
Alignment:
Q |
57 |
gcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||||| ||||||||||||||||| || ||| |||||||||||||||||||| |
|
|
T |
10455789 |
gcccctgcatataacaatgcatgttcctgccaactgaactatgctcacggggac |
10455736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 115
Target Start/End: Complemental strand, 30833063 - 30833006
Alignment:
Q |
58 |
cccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggacgtaat |
115 |
Q |
|
|
||||| |||||||||||||||||| || ||| ||||||||||||| |||||| |||| |
|
|
T |
30833063 |
cccctgcatataacaatgcatgtccctgccaactgaactatgctcatggggacttaat |
30833006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 110
Target Start/End: Complemental strand, 34524922 - 34524869
Alignment:
Q |
57 |
gcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||||| |||||||||||||||||| || ||| ||| |||||||||||||||| |
|
|
T |
34524922 |
gcccctgcatataacaatgcatgtccctgccaactgagctatgctcacggggac |
34524869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 109
Target Start/End: Complemental strand, 12341468 - 12341416
Alignment:
Q |
57 |
gcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacgggga |
109 |
Q |
|
|
|||||||||||||| |||| |||| |||||| ||||||||||||||||||| |
|
|
T |
12341468 |
gcccctacatataataatgtatgttcctgtcaactgaactatgctcacgggga |
12341416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 109
Target Start/End: Complemental strand, 31639188 - 31639136
Alignment:
Q |
57 |
gcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacgggga |
109 |
Q |
|
|
|||||||||||||||||||| |||| |||||| ||| |||||||||||||| |
|
|
T |
31639188 |
gcccctacatataacaatgcgtgtccctgtcaactgagttatgctcacgggga |
31639136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 112
Target Start/End: Complemental strand, 24119346 - 24119298
Alignment:
Q |
64 |
catataacaatgcatgtcagtgtcaattgaactatgctcacggggacgt |
112 |
Q |
|
|
|||||||||||||||||| |||||| ||||||||| |||||||||||| |
|
|
T |
24119346 |
catataacaatgcatgtccttgtcaactgaactatgttcacggggacgt |
24119298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 7906372 - 7906427
Alignment:
Q |
55 |
cagcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||||||| |||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
T |
7906372 |
cagcccctgcatataacaatgcatgtccctaccaactgaactatgctcacggggac |
7906427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 54 - 107
Target Start/End: Original strand, 7015732 - 7015785
Alignment:
Q |
54 |
tcagcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggg |
107 |
Q |
|
|
|||||||||||||||||||||||||||| | ||| ||| ||||||||||||| |
|
|
T |
7015732 |
tcagcccctacatataacaatgcatgtcccagccaactgagctatgctcacggg |
7015785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 110
Target Start/End: Complemental strand, 18003863 - 18003810
Alignment:
Q |
57 |
gcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||||| |||||||||||||||||| || ||| ||| |||||||||||||||| |
|
|
T |
18003863 |
gcccctgcatataacaatgcatgtccctgccaactgagctatgctcacggggac |
18003810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 110
Target Start/End: Original strand, 52961130 - 52961183
Alignment:
Q |
57 |
gcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||||| |||||||||||||||||| || ||| ||| |||||||||||||||| |
|
|
T |
52961130 |
gcccctgcatataacaatgcatgtccttgccaactgagctatgctcacggggac |
52961183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 110
Target Start/End: Original strand, 9768858 - 9768910
Alignment:
Q |
58 |
cccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
||||| |||||||||||||||||| || ||| ||| |||||||||||||||| |
|
|
T |
9768858 |
cccctgcatataacaatgcatgtccctgccaactgagctatgctcacggggac |
9768910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 110
Target Start/End: Original strand, 34081 - 34134
Alignment:
Q |
57 |
gcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||||| |||||||||||||||||| || ||| ||| |||||||||||||||| |
|
|
T |
34081 |
gcccctgcatataacaatgcatgtccctgccaactgagctatgctcacggggac |
34134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 110
Target Start/End: Original strand, 16874238 - 16874291
Alignment:
Q |
57 |
gcccctacatataacaatgcatgtcagtgtcaattgaactatgctcacggggac |
110 |
Q |
|
|
|||||| |||||||||||||||||| || ||| ||| |||||||||||||||| |
|
|
T |
16874238 |
gcccctgcatataacaatgcatgtccctgccaactgagctatgctcacggggac |
16874291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 58 - 106
Target Start/End: Original strand, 3461773 - 3461821
Alignment:
Q |
58 |
cccctacatataacaatgcatgtcagtgtcaattgaactatgctcacgg |
106 |
Q |
|
|
|||||||||||||||||||||||| |||||| ||| ||||||||||| |
|
|
T |
3461773 |
cccctacatataacaatgcatgtccctgtcaactgagttatgctcacgg |
3461821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University