View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0821_low_96 (Length: 246)
Name: NF0821_low_96
Description: NF0821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0821_low_96 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 9 - 246
Target Start/End: Original strand, 54673990 - 54674231
Alignment:
Q |
9 |
caataatataaattgtcaaatagatcatttatttaggga----gggagtattgttatgctaaaacaacgattgtgcaatactgccactaatgtctctctt |
104 |
Q |
|
|
|||||||||| ||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
54673990 |
caataatatatattgtcaaacagatcatttatttagggacggagggagtattattatgctaaaacaacgattgtgcaatactgccagtaatgtctctctt |
54674089 |
T |
 |
Q |
105 |
ggaggtacaagaatcgcattactcttcccacgtggtatatatattcaattcttgcatgagtttggaagatgtaatacacgggtaccggacttaaacaagg |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54674090 |
ggaggtacaagaatcgcattactcttcccacgtggtatatatattcaattcttgcatgagtttggaagatgtaatacacgggtaccggacttaaacaagg |
54674189 |
T |
 |
Q |
205 |
tttaggctaaggtaggagatttgtataggtctcttttaccgt |
246 |
Q |
|
|
||||||||| ||||||||| ||||||||||||| ||||||| |
|
|
T |
54674190 |
tttaggctacggtaggagacctgtataggtctctcttaccgt |
54674231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 47
Target Start/End: Original strand, 33121754 - 33121792
Alignment:
Q |
9 |
caataatataaattgtcaaatagatcatttatttaggga |
47 |
Q |
|
|
|||||||||| ||||||||| |||||||||||||||||| |
|
|
T |
33121754 |
caataatatatattgtcaaacagatcatttatttaggga |
33121792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University