View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0822_high_6 (Length: 331)

Name: NF0822_high_6
Description: NF0822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0822_high_6
NF0822_high_6
[»] chr3 (1 HSPs)
chr3 (29-134)||(40469694-40469799)
[»] chr7 (1 HSPs)
chr7 (151-187)||(25483705-25483741)


Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 29 - 134
Target Start/End: Complemental strand, 40469799 - 40469694
Alignment:
29 agaaagattacaaaaaattaagagcataaatgttatcatagtggcaaacttgttgctgatcaaaatttggcgtgtttggtgacaagtttttcttatcaac 128  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
40469799 agaaagattacaaaaaattaagagcataaatgatatcatagtggcaaacttgttgctgatcaaaatttggcgtgtttgatgacaagtttttcttatcaac 40469700  T
129 ttgtaa 134  Q
    ||||||    
40469699 ttgtaa 40469694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 151 - 187
Target Start/End: Original strand, 25483705 - 25483741
Alignment:
151 atttcaattagtttttgaacttatagtttatagcttt 187  Q
    ||||||| |||||||||| ||||||||||||||||||    
25483705 atttcaagtagtttttgagcttatagtttatagcttt 25483741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 479 times since January 2019
Visitors: 5838